Overview
Sequences
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGACTGCGCCAGCAAGAGCAGAAATCCTGCATCTATTCCGGTCACTCCTGCGTGAAGCTCGTAAATTCCCCGACTACAATATCAGAGAATACGCTAAGAGAAGAACCATCGATGCCTTCCGTCACAACAAATCACTATCAGATCCTTCTTCCATCTCTCAAGCCTTCGCTGAGGCCAACTCTCAGCTCGACGTCGCTAAGCGCCAAGCTGTTGTTTACTCCCTTTATGCCCCCAAAGTTCGGAGCATTATGGAAGTCCCCAACGAATAG ATGACTGCGCCAGCAAGAGCAGAAATCCTGCATCTATTCCGGTCACTCCTGCGTGAAGCTCGTAAATTCCCCGACTACAATATCAGAGAATACGCTAAGAGAAGAACCATCGATGCCTTCCGTCACAACAAATCACTATCAGATCCTTCTTCCATCTCTCAAGCCTTCGCTGAGGCCAACTCTCAGCTCGACGTCGCTAAGCGCCAAGCTGTTGTTTACTCCCTTTATGCCCCCAAAGTTCGGAGCATTATGGAAGTCCCCAACGAATAG ATGACTGCGCCAGCAAGAGCAGAAATCCTGCATCTATTCCGGTCACTCCTGCGTGAAGCTCGTAAATTCCCCGACTACAATATCAGAGAATACGCTAAGAGAAGAACCATCGATGCCTTCCGTCACAACAAATCACTATCAGATCCTTCTTCCATCTCTCAAGCCTTCGCTGAGGCCAACTCTCAGCTCGACGTCGCTAAGCGCCAAGCTGTTGTTTACTCCCTTTATGCCCCCAAAGTTCGGAGCATTATGGAAGTCCCCAACGAATAG MTAPARAEILHLFRSLLREARKFPDYNIREYAKRRTIDAFRHNKSLSDPSSISQAFAEANSQLDVAKRQAVVYSLYAPKVRSIMEVPNE Relationships
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
Homology
BLAST of Spo21317.1 vs. NCBI nr
Match: gi|902184451|gb|KNA10296.1| (hypothetical protein SOVF_145730 [Spinacia oleracea]) HSP 1 Score: 171.8 bits (434), Expect = 5.400e-40 Identity = 89/89 (100.00%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of Spo21317.1 vs. NCBI nr
Match: gi|731362971|ref|XP_010693177.1| (PREDICTED: LYR motif-containing protein 4B [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 146.4 bits (368), Expect = 2.400e-32 Identity = 71/86 (82.56%), Postives = 80/86 (93.02%), Query Frame = 1
BLAST of Spo21317.1 vs. NCBI nr
Match: gi|698528689|ref|XP_009761176.1| (PREDICTED: LYR motif-containing protein 4 [Nicotiana sylvestris]) HSP 1 Score: 127.5 bits (319), Expect = 1.200e-26 Identity = 62/86 (72.09%), Postives = 74/86 (86.05%), Query Frame = 1
BLAST of Spo21317.1 vs. NCBI nr
Match: gi|460380605|ref|XP_004236045.1| (PREDICTED: LYR motif-containing protein 4 [Solanum lycopersicum]) HSP 1 Score: 127.1 bits (318), Expect = 1.500e-26 Identity = 61/86 (70.93%), Postives = 74/86 (86.05%), Query Frame = 1
BLAST of Spo21317.1 vs. NCBI nr
Match: gi|697139318|ref|XP_009623746.1| (PREDICTED: LYR motif-containing protein 4 [Nicotiana tomentosiformis]) HSP 1 Score: 126.3 bits (316), Expect = 2.600e-26 Identity = 61/86 (70.93%), Postives = 74/86 (86.05%), Query Frame = 1
BLAST of Spo21317.1 vs. UniProtKB/TrEMBL
Match: A0A0K9QUX3_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_145730 PE=3 SV=1) HSP 1 Score: 171.8 bits (434), Expect = 3.800e-40 Identity = 89/89 (100.00%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of Spo21317.1 vs. UniProtKB/TrEMBL
Match: A0A0J8BEC0_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_2g046300 PE=3 SV=1) HSP 1 Score: 146.4 bits (368), Expect = 1.700e-32 Identity = 71/86 (82.56%), Postives = 80/86 (93.02%), Query Frame = 1
BLAST of Spo21317.1 vs. UniProtKB/TrEMBL
Match: A0A0V0GXH7_SOLCH (Putative LYR motif-containing protein 4-like OS=Solanum chacoense PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 1.100e-26 Identity = 61/86 (70.93%), Postives = 74/86 (86.05%), Query Frame = 1
BLAST of Spo21317.1 vs. UniProtKB/TrEMBL
Match: K4BL51_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 1.100e-26 Identity = 61/86 (70.93%), Postives = 74/86 (86.05%), Query Frame = 1
BLAST of Spo21317.1 vs. UniProtKB/TrEMBL
Match: M1CAK5_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400024653 PE=3 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 1.100e-26 Identity = 61/86 (70.93%), Postives = 74/86 (86.05%), Query Frame = 1
BLAST of Spo21317.1 vs. ExPASy Swiss-Prot
Match: LYRM4_TAEGU (LYR motif-containing protein 4 OS=Taeniopygia guttata GN=LYRM4 PE=3 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 8.200e-12 Identity = 37/87 (42.53%), Postives = 58/87 (66.67%), Query Frame = 1
BLAST of Spo21317.1 vs. ExPASy Swiss-Prot
Match: LYM4B_SALSA (LYR motif-containing protein 4B OS=Salmo salar GN=lyrm4b PE=3 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.400e-11 Identity = 34/83 (40.96%), Postives = 51/83 (61.45%), Query Frame = 1
BLAST of Spo21317.1 vs. ExPASy Swiss-Prot
Match: LYRM4_HUMAN (LYR motif-containing protein 4 OS=Homo sapiens GN=LYRM4 PE=1 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.000e-10 Identity = 34/77 (44.16%), Postives = 49/77 (63.64%), Query Frame = 1
BLAST of Spo21317.1 vs. ExPASy Swiss-Prot
Match: LYRM4_MOUSE (LYR motif-containing protein 4 OS=Mus musculus GN=Lyrm4 PE=1 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.900e-10 Identity = 32/77 (41.56%), Postives = 49/77 (63.64%), Query Frame = 1
BLAST of Spo21317.1 vs. ExPASy Swiss-Prot
Match: LYRM4_BOVIN (LYR motif-containing protein 4 OS=Bos taurus GN=LYRM4 PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 7.600e-10 Identity = 32/77 (41.56%), Postives = 49/77 (63.64%), Query Frame = 1
BLAST of Spo21317.1 vs. TAIR (Arabidopsis)
Match: AT5G61220.1 (LYR family of Fe/S cluster biogenesis protein) HSP 1 Score: 97.8 bits (242), Expect = 3.500e-21 Identity = 48/80 (60.00%), Postives = 63/80 (78.75%), Query Frame = 1
The following BLAST results are available for this feature:
BLAST of Spo21317.1 vs. NCBI nr
Analysis Date: 2018-06-29 (blastp Spinacia oleracea peptides vs. NCBI nr) Total hits: 5
BLAST of Spo21317.1 vs. UniProtKB/TrEMBL
Analysis Date: 2018-06-29 (blastp Spinacia oleracea peptides vs. UniprotKB/TrEMBL) Total hits: 5
BLAST of Spo21317.1 vs. ExPASy Swiss-Prot
Analysis Date: 2018-06-29 (blastp Spinacia oleracea peptides vs. ExPASy SwissProt) Total hits: 5
BLAST of Spo21317.1 vs. TAIR (Arabidopsis)
Analysis Date: 2018-06-29 (blastp Spinacia oleracea peptides vs. TAIR) Total hits: 1
InterPro
Analysis Name: InterPro Annotations of S. oleracea
Date Performed: 2018-06-29
|